Entropie: Biologie

Aus Wikibooks
Wechseln zu: Navigation, Suche

Zurück zur Übersicht

Widerspricht die biologische Evolution dem 2.Hauptsatz ?

Biologische Lebewesen sind Entropieerzeugende Systeme[Bearbeiten]

Jedes Tier nimmt entropiearme (und energiereiche) Nahrung zu sich und gibt entropiereiche Abfallstoffe wieder ab.

Interessant ist beispielsweise die Entropiebilanz eines Menschen.

Bei Pflanzen wird entropiearmes Licht von der Sonne aufgenommen und entropiereiche Wärmestrahlung wieder abgegeben.


Entropie und Lebensentstehung[Bearbeiten]

Entropie und Evolution[Bearbeiten]

Zitate[Bearbeiten]

Keine Entropie in der Evolution ?[Bearbeiten]

In dem Buch Ketten für Prometheus: Gegen die Natur oder mit ihr? Von Reinhard Demoll wird auf Seite 239 die Ansicht geäußert:

Im Reich der Organismen gibt es keine Entropie 
sondern nur ein Sich-Hinaufentwickeln, 
den Drang zur Vervollkommnung des Typus; 
und dies äußert sich im Geistigen ebenso wie im Körperlichen. 

Von Reinhard Demoll Veröffentlicht 1954 F. Bruckmann 248 Seiten

Diese Ansicht ist aus heutiger Sicht falsch. Einmal ist bei der Rekombination und der Variation des Erbgutes der Zufall und damit auch die Entropie im Spiel. Außerdem kann die Evolution nur deswegen ablaufen, da durch den steten Energiestrom der Sonne die Entropie der Sonne und des umgebenden Weltraums erhöht wird und damit der Entropieverlust durch die Evolution ausgeglichen wird.

Entropie und Gesundheit[Bearbeiten]

Zitat

Es gibt nur eine Möglichkeit gesund zu sein, 
aber tausend Möglichkeiten krank zu sein.

Entropie im genetischen Code[Bearbeiten]

Sie haben eine Gensequenz und versuchen die Entropie dieser Sequenz zu berechnen ? Macht so eine Berechnung überhaupt Sinn ? Wie ändert sich die Berechnung, wenn man immer Triplets betrachtet ? Es sind ja immer zwei Basenpaare gekoppelt g und c sowie a und t, kann man das Ausnutzen, um die Redundanz zu reduzieren ? Wie schaut eine 01 Kodierung für Gene aus ? Beispielsweise

a    00
c    01
g    10
t    11

Gibt es dazu einen Standard ?

   1 gagcagcgcg cgcaagcagg ccaggggaag gtgggcgcag gtgaggggcc gaggtgtgcg
  61 caggacttta gccggttgag aaggatcaag caggcatttg gagcacaggt gtctagaaac
 121 ttttaagggg ccggttcaag aaggaaaagt tcccttctgc tgtgaaacta tttggcaaga
 181 ggctggaggg cccaatggct gcaaaattgc aacccaacat tcccaaagcc aagagtctag
 241 atggcgtcac caatgacaga accgcatctc aagggcagtg gggccgtgcc tgggaggtgg
 301 actggttttc actggcgagc gtcatcttcc tactgctgtt cgcccccttc atcgtctact
 361 acttcatcat ggcttgtgac cagtacagct gcgccctgac cggccctgtg gtggacatcg
 421 tcaccggaca tgctcggctc tcggacatct gggccaagac tccacctata acgaggaaag
 481 ccgcccagct ctataccttg tgggtcacct tccaggtgct tctgtacacg tctctccctg
 541 acttctgcca taagtttcta cccggctacg taggaggcat ccaggagggg gccgtgactc
 601 ctgcaggggt tgtgaacaag tatcagatca acggcctgca agcctggctc ctcacgcacc
 661 tgctctggtt tgcaaacgct catctcctgt cctggttctc gcccaccatc atcttcgaca
 721 actggatccc actgctgtgg tgcgccaaca tccttggcta tgccgtctcc accttcgcca
 781 tggtcaaggg ctacttcttc cccaccagcg ccagagactg caaattcaca ggcaatttct
 841 tttacaacta catgatgggc atcgagttta accctcggat cgggaagtgg tttgacttca
 901 agctgttctt caatgggcgc cccgggatcg tcgcctggac cctcatcaac ctgtccttcg
 961 cagcgaagca gcgggagctc cacagccatg tgaccaatgc catggtcctg gtcaacgtcc
1021 tgcaggccat ctacgtgatt gacttcttct ggaacgaaac ctggtacctg aagaccattg
1081 acatctgcca tgaccacttc gggtggtacc tgggctgggg cgactgtgtc tggctgcctt
1141 atctttacac gctgcagggt ctgtacttgg tgtaccaccc cgtgcagctg tccaccccgc
1201 acgccgtggg cgtcctgctg ctgggcctgg tgggctacta catcttccgg gtggccaacc
1261 accagaagga cctgttccgc cgcacggatg ggcgctgcct catctggggc aggaagccca
1321 aggtcatcga gtgctcctac acatccgccg acgggcagag gcaccacagc aagctgctgg
1381 tgtcgggctt ctggggcgtg gcccgccact tcaactacgt cggcgacctg atgggcagcc
1441 tggcctactg cctggcctgt ggcggtggcc acctgctgcc ctacttctac atcatctaca
1501 tggccatcct gctgacccac cgctgcctcc gggacgagca ccgctgcgcc agcaagtacg
1561 gccgggactg ggagcgctac accgccgcag tgccttaccg cctgctgcct ggaatcttct
1621 aagggcacgc cctagggaga agccctgtgg ggctgtcaag agcgtgttct gccaggtcca
1681 tgggggctgg catcccagct ccaactcgag gagcctcagt ttcctcatct gtaaactgga
1741 gagagcccag cacttggcag gtgtccagta cctaatcacg ctctgttcct tgcttttgcc
1801 ttcaagggaa ttccgagtgt ccagcactgc cgtattgcca gcacagacgg attttctcta
1861 atcagtgtcc ctgggcagga ggatgaccca gtcaccttta ctagtccttt ggagacaatt
1921 tacctgtatt aggagcccag gccacgctac actctgccca cactggtgag caggaggtct
1981 tcccacgccc tgtcattagg ctgcatttac tcttgctaaa taaaagtggg agtggggcgt
2041 gcgcgttatc catgtattgc ctttcagctc tagatccccc tcccctgcct gctctgcagt
2101 cgtgggtggg gcccgtgcgc cgtttctcct tggtagcgtg cacggtgttg aactgggaca
2161 ctggggagaa aggggctttc atgtcgtttc cttcctgctc ctgctgcaca gctgccagga
2221 gtgctctgcc tggagtctgc agacctcaga gaggtcccag cactggctgt ggctttcagg
2281 tgtaggcagg tgggctctgc ttcccgattc cctgtgagcg cccaccctct cgaaagaatt
2341 ttctgtcttg ccctgtgact gtgcagactc tggctcgagc aacccgggga acttcaccct
2401 caggggcctc tccacacctt ctccagcgag gaggtctcag tcccagcctc gggagggcac
2461 ctccttttct gtgctttctt ccctgaggca ttcttcctca tccctagggt gttgtgtaga
2521 actcttttta aactctatgc tccgagtaga gttcatcttt atattaaact tcccctgttc
2581 aaaaaaaaaa aaaaaaa

Häufigkeit der einzelnen Basen in einer Codesequenz[Bearbeiten]

Eine einfache Fragestellung bei der Betrachtung von DNS Sequenzen, ist die Frage nach der Häufigkeit der einzelnen Basen. Siehe dazu http://rosalind.info/problems/ini/

Gegeben ist ein DNS Strang von maximal 1000 Basen.

Gesucht wird die Anzahl von a,c,g und t in diesem Strang.

Rosalinds Beispiel : AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Berechnetes Ergebnis : 20 12 17 21

Basic Programm[Bearbeiten]

save"dnastat.bas

10 REM DNA ZAEHLEN
15 REM ZAEHLERAUFNULL
20 AZ = 0
30 CZ = 0
40 GZ = 0
50 TZ = 0
60 REM INPUT DNA SEQUENZ
70 DNA$ = "ACGTACGT"
80 REM N AS INTEGER
90 REM    DIM TEMP AS STRING, CHAR AS STRING * 1
110 REM TEMP = RTRIM$(LTRIM$(DNA$))
120 FOR N = 1 TO LEN(DNA$)
130 CHAR$ = MID$(DNA$, N, 1)
140 IF CHAR$ = "A" THEN AZ = AZ + 1
150 IF CHAR$ = "C" THEN CZ = CZ + 1
160 IF CHAR$ = "G" THEN GZ = GZ + 1
170 IF CHAR$ = "T" THEN TZ = TZ + 1
240 NEXT 
250 PRINT "AZ = ";AZ
260 PRINT "CZ = ";CZ
270 PRINT "GZ = ";GZ
280 PRINT "TZ = ";TZ

run AZ = 2 CZ = 2 GZ = 2 TZ = 2

Kopieren Sie ihre Sequenz in die Zeile 70 des Programmes und lassen sie es in Basic mit RUN laufen. In manchen Basicdialekten müssen die Zeilennummern noch herausgelöscht werden.

Redundanz im genetischen Code Quelle[Bearbeiten]

Entropies of biosequences: The role of repeats[Bearbeiten]

The American Physical Society 1994

  • Hanspeter Herzel
    • Institute of Theoretical Physics, Technical University, Hardenbergstrasse 36, D-10623 Berlin, Germany
  • Werner Ebeling and Armin O. Schmitt
    • Institute of Physics, Humboldt University, Invalidenstrasse 110, D-10115 Berlin, Germany

Received 23 May 1994

DNA sequences of higher organisms contain thousands of nearly identical dispersed repetitive sequences. In order to understand the effect of such repeats on word entropies, we construct a model that can be analyzed analytically. The hypothetical model sequences consist of independent equidistributed symbols with randomly interspersed repeats. As a conclusion, we predict that the entropy of DNA sequences measuring the information content is much lower than expected.

Links[Bearbeiten]