Information: Biologie

Aus Wikibooks
Wechseln zu: Navigation, Suche

Zurück zur Übersicht

In der Biologie taucht der Begriff Information an einigen ganz zentralen Stellen auf. Als sehr gutes, immer noch lesenswertes Buch kann man dazu empfehlen:

  • Haken, Hermann; Haken-Krell, Maria: Entstehung von biologischer Information und Ordnung. Dimensionen der modernen Biologie Band 31989, Wissenschaftliche Buchgesellschaft, 1989, ISBN 3-534-02533-4 (X, 218 S. m. 68 Abb. Gebunden.).

Information im Erbgut[Bearbeiten]

Auf der nebenstehenden Abbildung sind die Ebenen der Informationsspeicherung im Erbgut zu erkennen:

Chromosomenkondensation
  1. DNA- Doppelhelix Desoxyribonukleinsäure Doppelte Wendeltreppe
  2. Chromatinstrang (DNA in blau mit Histonen in grün)
  3. Kondensiertes Chromatin während der  Interphase mit Centromer
  4. Kondensiertes Chromatin während der  Prophase (nun aus zwei  Chromatiden bestehend, weil sich die DNA verdoppelt hat)
  5. Metaphasechromosom (Zwei-Chromatiden-Chromosom)

Vergessen wurde hier als erste Primärstruktur die Abfolge der Nukleotide: beispielsweise

  • AACTCGACTCCGGATTAGCAAGCC

und die Gliederung in Tripletts

  • AAC-TCG-ACT-CCG-GAT-TAG-CAA-GCC

Informationsneubildung bei der Evolution[Bearbeiten]

Informationsweitergabe bei der Fortpflanzung[Bearbeiten]

Informationsaufnahme durch sensible Zellen[Bearbeiten]

Informationsverarbeitung im Nervensystem[Bearbeiten]

Informationsverarbeitung im Hormonsystem[Bearbeiten]

Informationsweitergabe durch Pherormone[Bearbeiten]

Informationsspeicherung im Gehirn, lernende Zellen[Bearbeiten]

Informationsvernichtung beim Tod eines Lebewesens[Bearbeiten]

Krankmachende Information z. B. in Viren[Bearbeiten]

Informationsgehalt eines Menschen[Bearbeiten]

Interessant ist die gesamte Menge an Informationen, die in einem menschlichen Körper gespeichert sind. Daraus ergibt sich beispielsweise, dass das  Beamen Quatsch ist:

Ulrich Walter (Physiker, Astronaut und Professor für Weltraumtechnik)
„Ein Mensch besteht aus ungefähr 10 hoch 27 Atomen. Die Zahl der Quantenzustände, also Bits, in denen diese sich befinden, beträgt 10 hoch 10 hoch 42, also eine Eins mit 10 hoch 42 Nullen. Das ist eine unvorstellbar große Datenmenge. Egal wie hoch die Übertragungsbandbreite ist, das lässt sich nicht übertragen. Und da haben wir noch nicht darüber geredet, wie man diese Informationen gewinnt und wieder zu einem Menschen zusammenbaut.“